View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_low_144 (Length: 240)
Name: NF19358_low_144
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_low_144 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 6452659 - 6452864
Alignment:
| Q |
19 |
atgcattaaacattggtattggtatcccatatagctatagttaacaggagttaaccaatgaggtatgatgccacatatgcatnnnnnnnccaaatgtgag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6452659 |
atgcattaaacattggtattggtatcccatatagctatagttaacaggagttaaccaatgaggtatgatgccacatatgcatgggggggccaaatgtgag |
6452758 |
T |
 |
| Q |
119 |
gtatagactatagaagaggaggatattttggcctgccagtcaatcctcgttcataataaaaacgggaatattccaattggagaaatatgtattaaaggag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6452759 |
gtatagactatagaagaggaggatattttggcctgccagtcaatcctcgttcataataaaaacgggaatattccaattggagaaatatgtattaaaggag |
6452858 |
T |
 |
| Q |
219 |
aaaaat |
224 |
Q |
| |
|
|||||| |
|
|
| T |
6452859 |
aaaaat |
6452864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University