View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_low_147 (Length: 239)
Name: NF19358_low_147
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_low_147 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 52246888 - 52247095
Alignment:
| Q |
15 |
aatactattgccatgtaaatggtttcccttttgcttttttgatatatagaaaacaaattcgatactttgagatttacaacactcacaaacac--taatga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52246888 |
aatactattgccatgtaaatggtttcccttttgcttttttgatatatagaaaacaaattcgatactttgagatttacaacactcacaaacacactaatgg |
52246987 |
T |
|
| Q |
113 |
taacnnnnnnnncatgcaaatggtttttatttgaaattttagaatgagaactaataatataatttagatgcaatatatgtttgagaaagtagaaaggaga |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52246988 |
taacaaaaaaaacatgcaaatggtttttatttgaaattttagaatgagaactaataatataatttagatgcaatatatgtttgagaaagtagaaaggaga |
52247087 |
T |
|
| Q |
213 |
aagaaatt |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
52247088 |
aagaaatt |
52247095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 107
Target Start/End: Original strand, 12618416 - 12618463
Alignment:
| Q |
60 |
atagaaaacaaattcgatactttgagatttacaacactcacaaacact |
107 |
Q |
| |
|
||||||| |||| |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
12618416 |
atagaaatcaaactcgatactatgagatttacaacactcacagacact |
12618463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University