View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19358_low_151 (Length: 237)

Name: NF19358_low_151
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19358_low_151
NF19358_low_151
[»] chr6 (1 HSPs)
chr6 (12-222)||(4843266-4843476)


Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 12 - 222
Target Start/End: Original strand, 4843266 - 4843476
Alignment:
12 atagggataaaatcgagataaaaaat-atggagtataaactcaaatgcaagttgaactattgtataaaaatatggtataagctagtgaaaaaataatata 110  Q
    ||||||||||||| |||||||||||| || |||||||| ||||||||||| ||||||||  ||||||||| |||||||||||||||||||||||||||||    
4843266 atagggataaaattgagataaaaaatgattgagtataagctcaaatgcaacttgaactaccgtataaaaa-atggtataagctagtgaaaaaataatata 4843364  T
111 tgttggtgagaaaatgaacatcaccaaacaagccatttatacgtttatatgttagaagttattttgatgggatcgtaaaagatctttttcagcttaacta 210  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||    
4843365 tgttggtgaggaaatgaacatcaccaaacaagccatttatacgtttatatgttagaagttatttggatgagatcgtaaaggatctttttcagcttaacta 4843464  T
211 gaggttatgagt 222  Q
    ||||||||||||    
4843465 gaggttatgagt 4843476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University