View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19358_low_165 (Length: 220)

Name: NF19358_low_165
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19358_low_165
NF19358_low_165
[»] chr8 (1 HSPs)
chr8 (40-213)||(39233928-39234103)


Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 40 - 213
Target Start/End: Complemental strand, 39234103 - 39233928
Alignment:
40 attttgaaaactatatttttcaaaatgaaattcaagtttttaagttgtggttgcattgcgatccttgattacgaatataattatggtcaaatgaagctaa 139  Q
    |||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||  ||||||||||||||||||||||||    
39234103 attttgaaaactatatttttcaaaattaaattcaagtttttatgttgtggttgcattgcgatccttgattacgaggataattatggtcaaatgaagctaa 39234004  T
140 taatgccttaatcccagatcaaaaaattattgtaaactgctgggtataa--gtgtagacatttttcggtttctgtg 213  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||    
39234003 tgatgccttaatcccagatcaaaaaattattgtaaactgctgggtataagtgtgtagacatttttcggtttctgtg 39233928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University