View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_low_167 (Length: 219)
Name: NF19358_low_167
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_low_167 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 170
Target Start/End: Complemental strand, 25951565 - 25951412
Alignment:
| Q |
17 |
attgggtccttttcaagatgggtttaattatcttgaaaagaggtttgcaaatgaaaaagataaaattttgaagtggagagattctatgcttaaaataggt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25951565 |
attgggtccttttcaagatgggtttaattatcttgaaaagaggtttgcaaatgaaaaagataaaattttgaagtggagagactctatgcttaaaataggt |
25951466 |
T |
|
| Q |
117 |
ggtcttgctggctttgttttcaattctaggtatatctatcctttgtaatcacca |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25951465 |
ggtcttgctggctttgttttcaattctaggtatatctatattttgtaatcacca |
25951412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 170
Target Start/End: Complemental strand, 25960816 - 25960663
Alignment:
| Q |
17 |
attgggtccttttcaagatgggtttaattatcttgaaaagaggtttgcaaatgaaaaagataaaattttgaagtggagagattctatgcttaaaataggt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25960816 |
attgggtccttttcaagatgggtttaattatcttgaaaagaggtttgcaaatgaaaaagataaaattttgaagtggagagactctatgcttaaaataggt |
25960717 |
T |
|
| Q |
117 |
ggtcttgctggctttgttttcaattctaggtatatctatcctttgtaatcacca |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25960716 |
ggtcttgctggctttgttttcaattctaggtatatctatattttgtaatcacca |
25960663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University