View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19358_low_177 (Length: 202)

Name: NF19358_low_177
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19358_low_177
NF19358_low_177
[»] chr3 (1 HSPs)
chr3 (82-183)||(5576236-5576337)


Alignment Details
Target: chr3 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 82 - 183
Target Start/End: Original strand, 5576236 - 5576337
Alignment:
82 agacaattatgcagaaatcaaatcataaaaacctgttactatacaaacagccccaaacaatggtcttgcactgtatcgtcttctctcatggagcttccac 181  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
5576236 agacaattatgcagaagtcaaatcataaaaacctgttactatacaaacagccccaaacaatagtcttgcactgtatcgtcttctctcatggagcttccac 5576335  T
182 tt 183  Q
    ||    
5576336 tt 5576337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University