View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_low_60 (Length: 367)
Name: NF19358_low_60
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_low_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 246 - 352
Target Start/End: Original strand, 33197140 - 33197246
Alignment:
| Q |
246 |
caaacaaagtaacagctgtgtcatgaacaaggttcacatttcaatttgtgttgatatgtctcaccacaccaggacagtaatttcataacagatggtgttg |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33197140 |
caaacaaagtaacagctgtgtcatgaacaaggttcacatttcaatttgtgttgatatgtctcaccacaccaggacagtaatttcataacagatggtgttg |
33197239 |
T |
 |
| Q |
346 |
tgatttg |
352 |
Q |
| |
|
||||||| |
|
|
| T |
33197240 |
tgatttg |
33197246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 9 - 70
Target Start/End: Original strand, 33197081 - 33197142
Alignment:
| Q |
9 |
aagaaagttgcaagcatgatacattcagaataactttccaagagtgataagatagtatacaa |
70 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33197081 |
aagaaagtcgcaagcatgatacattcagaataactttccaagagtgataagatagtatacaa |
33197142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University