View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_low_63 (Length: 353)
Name: NF19358_low_63
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_low_63 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 173 - 336
Target Start/End: Complemental strand, 43905767 - 43905604
Alignment:
| Q |
173 |
cgcaattaggattatgtggttttcttttattttacgtttctactttagaaaatatactcttcatcttccttatccattcatgtgatcatcatattcnnnn |
272 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43905767 |
cgcaattaggattatgtggtttccttttattttacgtttctactttagaaaatatactcttcatcttccttatccattcatgtgatcatcatattctttt |
43905668 |
T |
|
| Q |
273 |
nnnagggagatattattttttgttaaacctttgataatgtccattttcagtgtctttttcaaga |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43905667 |
tttagggagatattattttttgttaaacctttgataatgtccattttcagtgtctttttcaaga |
43905604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 15 - 139
Target Start/End: Complemental strand, 43905925 - 43905801
Alignment:
| Q |
15 |
aatattgattgggtaaaaaattatagaccaaaaaagtatgttaaaattcaagaacggaggtgtgatatggattgattttatttttgccaataataataga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43905925 |
aatattgattgggtaaaaaattatagaccaaaaaagtatgttaaaattcaagaacggaggtgtgatatggattgattttatttttgccaataataataga |
43905826 |
T |
|
| Q |
115 |
tcaaatagattattaagcaactatt |
139 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
43905825 |
tcaaatagattattaagcaagtatt |
43905801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University