View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_low_79 (Length: 324)
Name: NF19358_low_79
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_low_79 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 86 - 305
Target Start/End: Original strand, 42272557 - 42272772
Alignment:
| Q |
86 |
ttttataatgtatttgtctctataaattagacatggaaatttaattatttttgtttctaatttcatggttgatttaacnnnnnnnagtatggcgactaat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |||||| |
|
|
| T |
42272557 |
ttttataatgtatttgtctctataaattagacatggaaatttaattatttttgtttctaatttcttggttgatttaactttttttagtatggcaactaat |
42272656 |
T |
 |
| Q |
186 |
ttctattcaaaatttagagaaaaagtcatgctagctctgacattattttgtcaaataaaatgtgtatgcaattaatttaattatgcagatgagaaccact |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42272657 |
ttctattcaaaatttagagaaaaagtcatgctagctctgacattattttgtcaaataaaatgtgtatgcaattaat----ttatgcagatgagaaccact |
42272752 |
T |
 |
| Q |
286 |
aatggaagaggagagggaac |
305 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42272753 |
aatggaagaggagagggaac |
42272772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University