View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_low_86 (Length: 310)
Name: NF19358_low_86
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_low_86 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 49; Significance: 5e-19; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 17 - 76
Target Start/End: Original strand, 19950442 - 19950502
Alignment:
| Q |
17 |
ataaataaataaatattgttcccaacaaaacaaattgtggg-ttgttgctacacacctttt |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
19950442 |
ataaataaataaatattgttcccaacaaaacaaattgtgggtttgttgctgcacacctttt |
19950502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 225 - 309
Target Start/End: Original strand, 19950651 - 19950737
Alignment:
| Q |
225 |
tatgtactccacaaaatttcgcaaactcgtatgaattttaat--nnnnnnnnntgtgattgaaaaatatatagtattaaaaaatgtg |
309 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19950651 |
tatgtactccacaaaattttgcaaactcgtatgaattttaataaaaaaaaaaatgtgattgaaaaatatatagtattaaaaaatgtg |
19950737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 158
Target Start/End: Original strand, 19950551 - 19950584
Alignment:
| Q |
125 |
ggactgatcaagtggtcaatcgtgaatgtatatc |
158 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
19950551 |
ggactgatcaagtgatcaatcgtgaatgtatatc |
19950584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University