View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_low_91 (Length: 302)
Name: NF19358_low_91
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_low_91 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 302
Target Start/End: Complemental strand, 31153429 - 31153154
Alignment:
| Q |
18 |
tttatgattttcatagaacattatggacccaatttagtgttgttctttttgtagtatttgtgttcgtagattaatatcggtcttttaccgatgagattaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31153429 |
tttatgattttcatagaacattatggacccaatttagtgttgttctttttgtagtatttgtgttcgtagattaatatcggtcttttaccgatgagatgaa |
31153330 |
T |
 |
| Q |
118 |
caacaatattagtcctgttttgatgaaatgaacaatacttgattgaaatttctcgtaagtcacaagagtatagttcaagcgttgaaacaaaagtaaacgt |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
31153329 |
caacaatattagtcctgttttgattaaatgaacaatacttgattgaaatttctcgtaagccacaagagtatagttc--------aaacaaaagtaaacgt |
31153238 |
T |
 |
| Q |
218 |
gtttacaatacaagggaggtaggtgtttctttcaaaccagatggggtaaacatgttatttaaggaaccctcagggaggaaagtgc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
31153237 |
gtttacaatacaagggaggtaggtgtttctttcaaactagatggggtaaacatgttatttaa-gaaacctcagggaggtaagtgc |
31153154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University