View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_low_92 (Length: 298)
Name: NF19358_low_92
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_low_92 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 16 - 283
Target Start/End: Original strand, 32415369 - 32415637
Alignment:
| Q |
16 |
atgaggaaataggtaatgacatgagttttgacatggcagcacgatgttatctgttacgcattgacagatgcataattgctgacaagagtaccatgtagat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32415369 |
atgaggaaataggtaatgacatgagttttgacatggcagcacgatgttatctgttacgcattgacagatgcataattgctgacaagagtaccatgtagat |
32415468 |
T |
|
| Q |
116 |
ttatgtgtcataaagttattctacgagtttatataatcacggtgcttatgcttggggtattgttattatcataatgtatttgtatgacca-tttgtttga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32415469 |
ttatgtgtcataaagttattctacgagtttagataatcacggtgcttatgcttggggtattgttattatcataatgtatttgtatgaccattttgtttga |
32415568 |
T |
|
| Q |
215 |
ggccaatttgcattacacaaacaagttgttaaaaatgttttaactcgtaatgttgccgagttaaattgt |
283 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32415569 |
ggtcaatttgcattacacaaacaagttgttaaaaatgttttaactcgtaatgttgccgagttaaattgt |
32415637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University