View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19359_high_4 (Length: 243)

Name: NF19359_high_4
Description: NF19359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19359_high_4
NF19359_high_4
[»] chr8 (2 HSPs)
chr8 (31-159)||(39906780-39906908)
chr8 (176-227)||(39906708-39906757)


Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 31 - 159
Target Start/End: Complemental strand, 39906908 - 39906780
Alignment:
31 atgtagggagatatgtactagaatctgattccatccaacggaagagttcgattaattgaactttgtatttannnnnnnnnnnnnnacggtagattaactg 130  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||              |||||||||||||||    
39906908 atgtagggagatatgtactagaatctgattccatccaactgaagagttcgattaattgaactttgtatttatttttattttttttacggtagattaactg 39906809  T
131 cactttgtatgaactgtgggcacgaataa 159  Q
    |||||||||||||||||||||||||||||    
39906808 cactttgtatgaactgtgggcacgaataa 39906780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 176 - 227
Target Start/End: Complemental strand, 39906757 - 39906708
Alignment:
176 ctatctatattgtctttaaacaaaggttggtgtaatttactcaccaactagt 227  Q
    ||||||| |||||||||||||||||||||  |||||||||||||||||||||    
39906757 ctatctagattgtctttaaacaaaggttg--gtaatttactcaccaactagt 39906708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University