View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19359_high_4 (Length: 243)
Name: NF19359_high_4
Description: NF19359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19359_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 31 - 159
Target Start/End: Complemental strand, 39906908 - 39906780
Alignment:
| Q |
31 |
atgtagggagatatgtactagaatctgattccatccaacggaagagttcgattaattgaactttgtatttannnnnnnnnnnnnnacggtagattaactg |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39906908 |
atgtagggagatatgtactagaatctgattccatccaactgaagagttcgattaattgaactttgtatttatttttattttttttacggtagattaactg |
39906809 |
T |
 |
| Q |
131 |
cactttgtatgaactgtgggcacgaataa |
159 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39906808 |
cactttgtatgaactgtgggcacgaataa |
39906780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 176 - 227
Target Start/End: Complemental strand, 39906757 - 39906708
Alignment:
| Q |
176 |
ctatctatattgtctttaaacaaaggttggtgtaatttactcaccaactagt |
227 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39906757 |
ctatctagattgtctttaaacaaaggttg--gtaatttactcaccaactagt |
39906708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University