View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1935_low_10 (Length: 229)
Name: NF1935_low_10
Description: NF1935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1935_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 43416758 - 43416607
Alignment:
| Q |
1 |
tagttaagctgtgcttcagatataatactctattgtcttgtcacttcagtatggcagcataagaattaggaataaaggaaagaatgcataaagaatctct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43416758 |
tagttaagctgtgcttcagatataatactctattgtcttgtcacttcagcatggcagcataagaattaggaataaaggaaagaatgcataaagaatctct |
43416659 |
T |
|
| Q |
101 |
tgtgcaacacttctttctcctatgataggagccaactacacttgtttctgtg |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43416658 |
tgtgcaacacttctttctcctatgataggagccaactacacttgtttctgtg |
43416607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 43401966 - 43401923
Alignment:
| Q |
109 |
acttctttctcctatgataggagccaactacacttgtttctgtg |
152 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||| |||| |
|
|
| T |
43401966 |
acttctttctcctatgataggagccaaatacacttatttttgtg |
43401923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University