View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19360_high_30 (Length: 255)
Name: NF19360_high_30
Description: NF19360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19360_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 20 - 147
Target Start/End: Complemental strand, 49135444 - 49135317
Alignment:
| Q |
20 |
tcatatttttgggtataataagaaggtgtcgttcgtggatgtgttcatttcgggttttagcaagggtgggacgggtggaggtgtagtctatttcagtgag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49135444 |
tcatatttttgggtataataagaaggtgtcgttcgtggatgtgttcatttcgggttttagcaagggtgggacgggtggaggtgtagtctatttcagtgag |
49135345 |
T |
 |
| Q |
120 |
aagaggagttagtggaggattgtacgta |
147 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
49135344 |
aagaggagttagtggaggattgtacgta |
49135317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University