View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19360_low_13 (Length: 389)
Name: NF19360_low_13
Description: NF19360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19360_low_13 |
 |  |
|
| [»] scaffold0543 (1 HSPs) |
 |  |  |
|
| [»] scaffold0492 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 5e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 16 - 111
Target Start/End: Complemental strand, 49971689 - 49971594
Alignment:
| Q |
16 |
cagatgcaaaagaacaaatgttcatggaattatctttgtgcgcaaggaattcaacagtgtgtcaacttttatttatttgaatactgccacaggttc |
111 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49971689 |
cagatgcaaaacaccaaatgttcatggaattatctttgtgcgcaaggaattcggcagtgtgtcaacttttatttatttgcatactgccacaggttc |
49971594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0543 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0543
Description:
Target: scaffold0543; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 2066 - 1999
Alignment:
| Q |
30 |
caaatgttcatggaattatctttgtgcgcaaggaattcaacagtgtgtcaacttttatttatttgaat |
97 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2066 |
caaatgttcatggaattatatttgtgcccaaggaattcaatcacatgtcaacttttatttatttgaat |
1999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0492
Description:
Target: scaffold0492; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 3612 - 3545
Alignment:
| Q |
30 |
caaatgttcatggaattatctttgtgcgcaaggaattcaacagtgtgtcaacttttatttatttgaat |
97 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3612 |
caaatgttcatggaattatatttgtgcccaaggaattcaatcacatgtcaacttttatttatttgaat |
3545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University