View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19360_low_23 (Length: 284)
Name: NF19360_low_23
Description: NF19360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19360_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 11 - 267
Target Start/End: Original strand, 3437194 - 3437450
Alignment:
| Q |
11 |
cagagatcaacggttgaaagataattgggctctcattcacgccgttcatcaagctaacaaagccaaagttcctgttgccgttgttttcaatctgtttgat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3437194 |
cagagatcaacggttgaaagataattgggctctcattcacgccgttcatcaagctaacaaagccaaagttcctgttgccgttgttttcaatctttttgat |
3437293 |
T |
 |
| Q |
111 |
cattttctcggtgcaaaggcgcgtcatttagggtttatgcttaagggtttgcgtcaattgtgtcaccaactgcaacattctcttcatataccctttttct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3437294 |
cattttctcggtgcaaaggcgcgtcatttagggtttatgcttaagggtttgcgtcaattgtgtcaccaactgcaacattctcttcatataccctttttct |
3437393 |
T |
 |
| Q |
211 |
tagttcgggtatatctttattttactctttttcttcttcaaagttcaaatttcaatt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3437394 |
tagttcgggtatatctttattttactctttttcttcttcaaagttcaaatttcaatt |
3437450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University