View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19360_low_27 (Length: 277)
Name: NF19360_low_27
Description: NF19360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19360_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 13770629 - 13770470
Alignment:
| Q |
1 |
ttgaagctcagcccgagccggagcctgtgcctttcaccatgcctgctgattgggacaacagcttcatggacttttggacttctgaagacatggttgatcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13770629 |
ttgaagctcagcccgagccggagcctgtgcctttcaccatgcctgctgattgggacagcatcttcatggacttttggacttctgaagacatggttgatcc |
13770530 |
T |
|
| Q |
101 |
catccgtcacctgctttataactaagaaactaataattattattgcaaaaatggaccacc |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13770529 |
catccgtcacctgttttataactaagaaactaataattattattgcaaaaatggaccacc |
13770470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 207 - 273
Target Start/End: Complemental strand, 13770423 - 13770357
Alignment:
| Q |
207 |
aaatttcgtgactgtataaactatgttgtttgtgttcttcctttatggtgttgtctcctttgcttct |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
13770423 |
aaatttcgtgactgtataaactatgttgtttgtgttcttcctttatggtgttgtctcttttgtttct |
13770357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University