View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19360_low_28 (Length: 259)
Name: NF19360_low_28
Description: NF19360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19360_low_28 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 86 - 259
Target Start/End: Complemental strand, 4884739 - 4884562
Alignment:
| Q |
86 |
gtaaagaagaaaataaactttgtttctgtcaattttgtgtacatatggttaaaattttagtgctatgataaaatgttatatatggttttgattttgttaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4884739 |
gtaaagaagaaaataaactttgtttctgtcaattttgtgtacatatggttaaaattttagtgctatgataaaatgttatatatggttttgattttgttaa |
4884640 |
T |
 |
| Q |
186 |
gttgaagacttgaactagaaggaagaaatcatcttgaaagttgacac----taagcttatagatcacatacttgtaag |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4884639 |
gttgaagacttgaactagaaggaagaaatcatcttgaaagttgacactaattaagcttatagatcacatacttgtaag |
4884562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University