View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19360_low_30 (Length: 255)

Name: NF19360_low_30
Description: NF19360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19360_low_30
NF19360_low_30
[»] chr4 (1 HSPs)
chr4 (20-147)||(49135317-49135444)


Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 20 - 147
Target Start/End: Complemental strand, 49135444 - 49135317
Alignment:
20 tcatatttttgggtataataagaaggtgtcgttcgtggatgtgttcatttcgggttttagcaagggtgggacgggtggaggtgtagtctatttcagtgag 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49135444 tcatatttttgggtataataagaaggtgtcgttcgtggatgtgttcatttcgggttttagcaagggtgggacgggtggaggtgtagtctatttcagtgag 49135345  T
120 aagaggagttagtggaggattgtacgta 147  Q
    ||||||||||||||||||||||||||||    
49135344 aagaggagttagtggaggattgtacgta 49135317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University