View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19361_high_36 (Length: 244)
Name: NF19361_high_36
Description: NF19361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19361_high_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 226
Target Start/End: Original strand, 8689463 - 8689675
Alignment:
| Q |
14 |
attattcttagagcatgaaacaaatggatgattttgagatgggaatgatatttcagtgtgaaatgagagatcgcttgacgatggttcggtgcttgttcct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8689463 |
attattcttagagcatgaaacaaatggatgattttgatatgggaatgatatttcagtgtgaaatgagagatcgcttgacgatggttcggtgcttgttcct |
8689562 |
T |
 |
| Q |
114 |
caaaatattggagagttaccgaatgttaatttgtgtgtgtttgaccttatgcatctggataacaagagttggaatactcctcttatatttgcaacttttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8689563 |
caaaatattggagagttaccgaatgttaatttgtgtgtgtttgaccttatgcatctggataacaagagttggaatactcctcttatatttgcaacttttt |
8689662 |
T |
 |
| Q |
214 |
attgggagattat |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8689663 |
attgggagattat |
8689675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University