View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19361_low_14 (Length: 433)
Name: NF19361_low_14
Description: NF19361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19361_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 73 - 294
Target Start/End: Original strand, 41741041 - 41741262
Alignment:
| Q |
73 |
tgttgccgtagaggaaaacaggtttgttacagtggacggaaatggcagcggcggtgatgatggtgaggggtttgaaggcacggcggagacgggaaggttg |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
41741041 |
tgttgccgtagaggaaaacaggtttgttacagtggacggaaatggcagcggcggtgatgatggtgaggggtttgaaggcaaggcggcgacgggaaggttg |
41741140 |
T |
|
| Q |
173 |
agagtagttgttgttgcatttagggagagaaggtttgttgttgtttttgcgagggccggaaaagatgttgttggatggaacaagagaagacatgttttgc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41741141 |
agagtagttgttgttgcatttagggagagaaggtttgttgttgtttttgcgagggccggaaaagatgttgttggatggaacaagagaagacatgttttgc |
41741240 |
T |
|
| Q |
273 |
agttgagaaggtgatagctgca |
294 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41741241 |
agttgagaaggtgatagctgca |
41741262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 41741312 - 41741364
Alignment:
| Q |
348 |
ggttttgaaagggtttttggttcccaaaatcaaaatattgactatggagtaaa |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41741312 |
ggttttgaaagggtttttggttcccaaaatcaaaatattgactatggactaaa |
41741364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University