View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19361_low_33 (Length: 249)
Name: NF19361_low_33
Description: NF19361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19361_low_33 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 3259620 - 3259380
Alignment:
| Q |
13 |
atatgaaccccgttgtacagacaaagataaaattattggaagtgaatcctatgaatccatggatattttataatgattcattcgnnnnnnnattagatat |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3259620 |
atatgaaccccgttgtacagacatagataaaattattggaagtgaatcctatgaatccatggatattttataatgattcattcgtttttttattagatat |
3259521 |
T |
 |
| Q |
113 |
gtatttgactcagttactcgtct----tagccgtcggatctgaaatttaagtataatgcatgtttgatatgagattgattcatcgtaattttgatatata |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3259520 |
gtatttgactcagttactcgtctgtcttagccgtcggatctgaaatttaagtataatgcatgtttgatatgagattgattcatcgtaattttgatatata |
3259421 |
T |
 |
| Q |
209 |
aattgtgatataaatgattgtctaactagcactagtatgct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3259420 |
aattgtgatataaatgattgtctaactagcactagtatgct |
3259380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University