View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19361_low_38 (Length: 237)
Name: NF19361_low_38
Description: NF19361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19361_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 3259347 - 3259138
Alignment:
| Q |
1 |
aaaagaaagttgtcctttttataagacatgttatggcctctgaacgttgcatatataattagtctaccacatgggtagcagcagattaatgtcgtacact |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3259347 |
aaaagaaagttgtcctttttaaaagacatgttatggcctctgaacgttgcata----attagtctaccacatgggtagcagcagattaatgtcgtacact |
3259252 |
T |
 |
| Q |
101 |
gaaaatataatcaaagtggaatcattcactcaattgtgatgcctcaaaccggtggttaactttctattttattttcagtttggatatttgacctgttagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3259251 |
gaaaatataatcaaagtggaatcattcactcaattgtgatgcctcaaaccggtggttaactttctattttattttcagtttggatatttgacctgttagt |
3259152 |
T |
 |
| Q |
201 |
tagaatttcattta |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3259151 |
tagaatttcattta |
3259138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University