View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19361_low_39 (Length: 229)
Name: NF19361_low_39
Description: NF19361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19361_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 38696073 - 38695863
Alignment:
| Q |
1 |
aggaagatgaacaggggaatgaggaaaaagatggagnnnnnnnccagtgtgctgggtttaggatattttactgaaaccttatcattcaatggtaaggaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38696073 |
aggaagatgaacaggggaatgaggaaaaagatggagaaaaaaaccagtgtgctgggtttaggatattttactgaaaccttatcattcaatggtaaggaag |
38695974 |
T |
|
| Q |
101 |
atttatgttttgtgaacaacctatataacttatacattcggacaattgccaagattcgaaactaatgcaagtaaaaatatgagctaaattaatcaccact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38695973 |
atttatgttttgtgaacaacctatataacttatacattcggacaattgccaagattcgaaactaatgcaagtaaaaatataagctaaattaatcaccact |
38695874 |
T |
|
| Q |
201 |
ccactaaaatc |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
38695873 |
ccactaaaatc |
38695863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University