View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19361_low_42 (Length: 218)
Name: NF19361_low_42
Description: NF19361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19361_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 13 - 133
Target Start/End: Complemental strand, 33629442 - 33629325
Alignment:
| Q |
13 |
aatatcattatgttttggtgtatcaggagttataacttcatgctcaataccnnnnnnnctcgcaaattttttcaaattcaatggaaatgtaatcacatga |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
33629442 |
aataccattatgttttggtgtatcaggagttataacttcatgctcaatacctttttttctcgcaaaatttttcaaattcaatggaaatgtaatcac---a |
33629346 |
T |
 |
| Q |
113 |
tccacatcggttctcaatttc |
133 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33629345 |
tccacatcggttctcaatttc |
33629325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 203
Target Start/End: Complemental strand, 33629295 - 33629224
Alignment:
| Q |
132 |
tcgcatcttaaatttcgtgaaatgagtgaatacattctttcaatcaaataaatccacatatacctaatgagt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33629295 |
tcgcatcttaaatttcgtgaaatgagtgaatacatcctttcaatcaaataaatccacatatacctaatgagt |
33629224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University