View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19361_low_44 (Length: 210)
Name: NF19361_low_44
Description: NF19361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19361_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 14 - 195
Target Start/End: Complemental strand, 19292543 - 19292364
Alignment:
| Q |
14 |
taaagttgctacatatatttgtgtattgttctgctaaaaccaagattagcttataggctaaaaacatccatcataatttaaacttgaaaagccaaacaaa |
113 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19292543 |
taaagttgctacatat--ttgtgtattgttctgctaaaaccaagattagcttatagcctaaaaacatccatcacaatttaaacttgaaaagccaaacaaa |
19292446 |
T |
 |
| Q |
114 |
aatctaaataagtccacttctagaagcaactttagaaacctataaatagacaaacatgtgtgcaattgtattcaaacctttg |
195 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19292445 |
aatctagataaatccacttctagaagcaactttagaaacctataaatagacaaacatgtgtgcaattgtattcaaacctttg |
19292364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University