View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19362_high_9 (Length: 241)
Name: NF19362_high_9
Description: NF19362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19362_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 26297736 - 26297938
Alignment:
| Q |
1 |
taatccgttctgataaactccagctcggtcagttcgtttacgtcactcgctttgataacgatgcttcctcttccgttccaagagtttctggtttgaaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26297736 |
taatccgttctgataaactccagctcggtcagttcgtttacgtcactcgctttgataacgatgcttcctcttccgttccaagagtttctggtttgaaaac |
26297835 |
T |
|
| Q |
101 |
tatttctaaaagaagagcttgtgttggtaatcctgttgatttggtttctactgattctttgcgacttgcagctttgaaactgaacggtaatgttaagaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
26297836 |
tatttctaaaagaagagcttgtgttggtaatcctgttgatttggtttctactgattctttaagacttgcaactgcgaaactgaatggtaatgttaagaag |
26297935 |
T |
|
| Q |
201 |
aag |
203 |
Q |
| |
|
||| |
|
|
| T |
26297936 |
aag |
26297938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University