View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19362_low_9 (Length: 249)
Name: NF19362_low_9
Description: NF19362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19362_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 44843446 - 44843210
Alignment:
| Q |
1 |
tttaagaattcggtatagtcttcgagagattttagcgctttgagttcaatataaatgctttatctctaagtctaaccctataaccattaaccacactctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44843446 |
tttaagaattcggtatagtcttcgagagattttagcgctttgagttcaatataaatgctttatctctaagtctaaccctataaccattaaccacactctc |
44843347 |
T |
|
| Q |
101 |
tctaaccctaagccctaaatacctctgctcccctctgcgtggaattcaaccaatggcttgtagctaccaccacgataatgaagttgacctgaagaacttc |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44843346 |
tctaaccctaagccct-aatacctctgctcccctctgcgtggaattcaatcaatggcttgtagctaccaccacgataatgaagctgacctgaagaacttc |
44843248 |
T |
|
| Q |
201 |
tccccaaaacttcgacaacaaatgcacgattacagaat |
238 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44843247 |
tccccaaaacttcgacaacaaatgcatgattacagaat |
44843210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University