View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19365_high_8 (Length: 214)
Name: NF19365_high_8
Description: NF19365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19365_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 197
Target Start/End: Original strand, 40380448 - 40380632
Alignment:
| Q |
13 |
cacagatgaggatttaaaatcaagattgtgatgaacttatacaagtaacagttgcttttggggacatacaagaattagaacgaacattgtgacgggctca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40380448 |
cacagatgaggatttaaaatcaagattgtgatgaacttatacaagtaacagttgcttttggggacatacaagaattagaacgaacattgtgacgggctca |
40380547 |
T |
|
| Q |
113 |
tagatttcgcgttctttggtttgatggtgacgacattggatgcagctgtttctcgaaacaatgttgctaataattgtgttgttac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40380548 |
tagatttcgcgttctttggtttgatggtgacgacattggatgcagctgtttctcgaaacaatgttgctaataattgtgttgttac |
40380632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 13 - 197
Target Start/End: Original strand, 40391789 - 40391973
Alignment:
| Q |
13 |
cacagatgaggatttaaaatcaagattgtgatgaacttatacaagtaacagttgcttttggggacatacaagaattagaacgaacattgtgacgggctca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40391789 |
cacagatgaggatttaaaatcaagattgtgatgaacttatacaagtaacagttgcttttggggacatacaagaattagaacgaacattgtgacgggctca |
40391888 |
T |
|
| Q |
113 |
tagatttcgcgttctttggtttgatggtgacgacattggatgcagctgtttctcgaaacaatgttgctaataattgtgttgttac |
197 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
40391889 |
tagatttcgcgttctttggtttgatggcgacgacattggatgcagctgtttctcgaaacaatgttgccaacaattgtgttgttac |
40391973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 125 - 197
Target Start/End: Complemental strand, 41054542 - 41054470
Alignment:
| Q |
125 |
tctttggtttgatggtgacgacattggatgcagctgtttctcgaaacaatgttgctaataattgtgttgttac |
197 |
Q |
| |
|
||||||||||||||| || |||| ||||||||||| || ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
41054542 |
tctttggtttgatggcgatgacaatggatgcagcttttgctcaaaacaatgttgccaataattgtgttgttac |
41054470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University