View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19366_high_17 (Length: 307)
Name: NF19366_high_17
Description: NF19366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19366_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 48 - 164
Target Start/End: Complemental strand, 33152743 - 33152627
Alignment:
| Q |
48 |
aggggattttgctgagcctgagagtacttctgggcggttggtgagtgctgaaggtgagatcgatgggcacgagcaaggggaggaagatggagatgaagat |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33152743 |
aggggattttgctgagcctgagagtacttctgggcggttggtgagtactgaaggtgagatcgatgggcatgagcaaggggaggaagatggagatgaagat |
33152644 |
T |
|
| Q |
148 |
gacaatggagagaccgg |
164 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33152643 |
gacaatggagagaccgg |
33152627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 254 - 307
Target Start/End: Complemental strand, 33152537 - 33152484
Alignment:
| Q |
254 |
attccttctcagaaactcttgtttttgttctttgcatgttgtgttatgtttgtt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33152537 |
attccttctcagaaactcttgtttttgttctttgcatgttgtgttatgtttgtt |
33152484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University