View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19366_high_3 (Length: 400)
Name: NF19366_high_3
Description: NF19366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19366_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 2e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 26 - 266
Target Start/End: Complemental strand, 34697312 - 34697071
Alignment:
| Q |
26 |
catcaaccaaatgaagccacgaacattgcacacgtccatgagatattatagaacataaccataccccgtgcgctca-ttctgggtgtgcgcacacgcgcc |
124 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||| ||||| |
|
|
| T |
34697312 |
catcaaccaaatgaagccatgaacattgcacacgtccatgagatattatagaacataaccataccccgtgctttaaattctgggtgtgcgcacgggcgcc |
34697213 |
T |
|
| Q |
125 |
cacacaaacacatgtaaatattgatatatattatgtccaagccttctgttttttaagaagggactataggaaatttagagtttgacacataagtaaagtt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34697212 |
cacacaaacacatgtaaatattgatatatattttgtccaaaccttctgttttttaagaagggactataggtaatttagagtttgacacataagtaaagtt |
34697113 |
T |
|
| Q |
225 |
tgatnnnnnnnttgttcagactaggatttaaatcagtttgtt |
266 |
Q |
| |
|
|||| ||||| | ||||||||||||||||||||||| |
|
|
| T |
34697112 |
tgataaaaaaattgttaaaactaggatttaaatcagtttgtt |
34697071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 264 - 371
Target Start/End: Complemental strand, 34695344 - 34695237
Alignment:
| Q |
264 |
gttttcaaatattcatctttaattgaaattatttaccacttaagttcaatcactttataaaaatgaatatttattaccttgaaattgatcaccagtaaag |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34695344 |
gttttcaaatattcatctttaattgaaattatttaccacttaagttcaatcactttataaaaattaatatttattaccttgaaattgatcaccagtaaag |
34695245 |
T |
|
| Q |
364 |
aggaatgg |
371 |
Q |
| |
|
|||||||| |
|
|
| T |
34695244 |
aggaatgg |
34695237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University