View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19366_high_7 (Length: 364)
Name: NF19366_high_7
Description: NF19366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19366_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 1 - 350
Target Start/End: Original strand, 52926080 - 52926429
Alignment:
| Q |
1 |
acatcatcagcatttactctggtgattgcggagcggtgagcacgatcctcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926080 |
acatcatcagcatttactctggtgattgcggagcggtgagcacgatcttcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagg |
52926179 |
T |
 |
| Q |
101 |
gtggaacgggagcatcctgtgggttggtttcagcagcaacagtactgagtgcttggtcaagaacataaatgaaagaggaagaatcgaagtcttgttgaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926180 |
gtggaacgggagcatcctgtgggttggtttcagcagcaacagtactgagtgcttggtcaagaacataaatgaaagaggaagaatcgaagtcttgttgaga |
52926279 |
T |
 |
| Q |
201 |
gcgatagcaaacaaagagaccgcaaccgatgcaattcatgcggaattgtttctcgagtttgccttggccacgctttaagagaacgttgccagcttcgtga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926280 |
gcgatagcaaacaaagagaccgcaaccgatgcaattcatgcggaattgtttctcgagtttgccttggccacgctttaagagaacgttgccagcttcgtga |
52926379 |
T |
 |
| Q |
301 |
atattgaatcttgcaagatgtttggtcttatccaaaacgtaagctctgtc |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926380 |
atattgaatcttgcaagatgtttggtcttatccaaaacgtaagctctgtc |
52926429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University