View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19367_high_1 (Length: 586)
Name: NF19367_high_1
Description: NF19367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19367_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 1330009 - 1329719
Alignment:
| Q |
1 |
cttgcatggctgcattcatttctccttgtttatacataccatccaacaataatgtatcaaagcctccacctaatgcaggctgctggtttcctaagtggct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1330009 |
cttgcatggctgcattcatttctccttgtttatacataccatccaacaataatgtatcaaagcctccacctaatgcaggctgctggtttcctaagtggct |
1329910 |
T |
 |
| Q |
101 |
ggttgattgtaccaacgctgtttcccaatctgcactctcgtcaaatgcatgccatggaagtgcttttattccaccttcacttgttgctggtgcagcccca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329909 |
ggttgattgtaccaacgctgtttcccaatctgcactctcatcaaatgcatgccatggaagtgcttttattccaccttcacttgttgctggtgcagcccca |
1329810 |
T |
 |
| Q |
201 |
tcaaataaagctaaggcaagtttgtccccatgttcttcagttgtcactctatcatctcctaagttcaacaaatcaccctcggtttgcacaa |
291 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329809 |
tcaaataaagctaaggctagtttgtccccatgttcttcagttgtcactctatcatctcctaagttcaacaaatcaccctcggtttgcacaa |
1329719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 341 - 577
Target Start/End: Complemental strand, 1329669 - 1329433
Alignment:
| Q |
341 |
ggctggttcctctggtggtggaagggccttgacttcattcatatcctcttccggttcaggttcgggttcgggttccttggcttcttcatccgaattgttc |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329669 |
ggctggttcctctggtggtggaagggccttgactgcattcatatcctcttccggttcaggttcgggttcgggttccttggcttcttcatccgaattgttc |
1329570 |
T |
 |
| Q |
441 |
tcttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataacctctaacttctttggtgtgaccttatctatct |
540 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329569 |
tcttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataacctctaacttctttggtgtgaccttatctatct |
1329470 |
T |
 |
| Q |
541 |
cagggtactcagaagagcgacaaattccaatattctt |
577 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329469 |
cagggtactcagaagagcgacaaattccaatattctt |
1329433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University