View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19367_high_10 (Length: 228)

Name: NF19367_high_10
Description: NF19367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19367_high_10
NF19367_high_10
[»] chr3 (3 HSPs)
chr3 (18-210)||(7675053-7675245)
chr3 (37-210)||(7659426-7659599)
chr3 (19-210)||(7624068-7624259)


Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 7675245 - 7675053
Alignment:
18 caaagggccataggtttcagccaaggttgcaagagattggtgtggtgcagggccaaggtgtggtaagttacctattattggccatggttttggtccaggt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7675245 caaagggccataggtttcagccaaggttgcaagagattggtgtggtgcagggccaaggtgtggtaagttacctattattggccatggttttggtccaggt 7675146  T
118 gggagtggtagtgatgaagttcttgttgcaaacttcaccagacggtatattaagattgataatatgcaactagagaatgcaatgagccataga 210  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
7675145 gggagtggtagtgatgaagttcttgttgcaaacttcaccaaacggtatattaagattgataatatgcaactagagaatgcaatgagccataga 7675053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 37 - 210
Target Start/End: Complemental strand, 7659599 - 7659426
Alignment:
37 gccaaggttgcaagagattggtgtggtgcagggccaaggtgtggtaagttacctattattggccatggttttggtccaggtgggagtggtagtgatgaag 136  Q
    ||||||| ||||| ||| |||||||| ||||| || | |||||| | |||||||||||| ||||||||||||||||||||||| ||||||||||||||||    
7659599 gccaaggctgcaatagactggtgtggggcaggacccaagtgtggcatgttacctattataggccatggttttggtccaggtggaagtggtagtgatgaag 7659500  T
137 ttcttgttgcaaacttcaccagacggtatattaagattgataatatgcaactagagaatgcaatgagccataga 210  Q
     |||| ||||||| ||||  | ||||||||| | |||  ||||| || ||||||  |||||||||| |||||||    
7659499 atctttttgcaaatttcataaaacggtatatgaggatgcataatgtgaaactagctaatgcaatgaaccataga 7659426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 19 - 210
Target Start/End: Original strand, 7624068 - 7624259
Alignment:
19 aaagggccataggtttcagccaaggttgcaagagattggtgtggtgcagggccaaggtgtggtaagttacctattattggccatggttttggtccaggtg 118  Q
    |||||||||| | |||  ||||||| ||||| ||| |||||||| ||||| || | |||||| | |||||||||||| ||||||||||||||||||||||    
7624068 aaagggccatggatttttgccaaggctgcaatagactggtgtggggcaggacccaagtgtggcatgttacctattataggccatggttttggtccaggtg 7624167  T
119 ggagtggtagtgatgaagttcttgttgcaaacttcaccagacggtatattaagattgataatatgcaactagagaatgcaatgagccataga 210  Q
    | |||||||||||||||| |||| ||||||| ||||  | ||||||||| | |||  ||||| || ||||||  | |||||||| |||||||    
7624168 gaagtggtagtgatgaagatctttttgcaaatttcataaaacggtatatgaggatgcataatgtgaaactagctattgcaatgaaccataga 7624259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University