View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19367_high_7 (Length: 247)
Name: NF19367_high_7
Description: NF19367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19367_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 52391477 - 52391653
Alignment:
| Q |
15 |
caaagggaaaaggaacataaaaaatttagcctccaatcatcattagtttttgtaatatcactaataagattccctcttcaagttggaacaggaattctgt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52391477 |
caaagggaaaaggaacataaaaaatttagcctccaatcatcattagtttttgtaatatcactaataagattccctcttcaagttggaac------cctgt |
52391570 |
T |
 |
| Q |
115 |
tccaattttgagagtttaaaaggtatgagaagggatggcttcagaggtggaaaatataggagggaatgtggaaatcttgtaca |
197 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52391571 |
tccaattttgagagtttgaaaggtatgagaagggatgacttcagagttggaaaatataggagggaatgtggaaatcttgtaca |
52391653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University