View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19367_low_17 (Length: 201)
Name: NF19367_low_17
Description: NF19367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19367_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 12 - 173
Target Start/End: Complemental strand, 385983 - 385822
Alignment:
| Q |
12 |
agaatatcccatggtcttcatttcaagtagaactttggcagcaacatccacaagcttcttattagccagtagagataaaagaacagtgtaagtgcttagg |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
385983 |
agaatatcccatcgtcttcatttcaagtagaactttggcagcaacatccacaagcttcttattagccagtagagataaaagaacagtgtaagtgcttagg |
385884 |
T |
|
| Q |
112 |
cctggccttaaacctgcattagtcattgaattgtacagtttgatggcatgatcaatttgtcc |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
385883 |
cctggccttaaacctgcattagtcattgaattgtacagtttcatggcatgatcaatttgtcc |
385822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 12 - 185
Target Start/End: Original strand, 38729559 - 38729732
Alignment:
| Q |
12 |
agaatatcccatggtcttcatttcaagtagaactttggcagcaacatccacaagcttcttattagccagtagagataaaagaacagtgtaagtgcttagg |
111 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||| ||| |
|
|
| T |
38729559 |
agaatatcccattgtcttcatttcaagtagaactttggcagcaacatccaccagcttcttattagcaagtagagataaaagaacagtataagtgctcagg |
38729658 |
T |
|
| Q |
112 |
cctggccttaaacctgcattagtcattgaattgtacagtttgatggcatgatcaatttgtccagacgcagcatg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
38729659 |
cctggccttaaacctgcattagtcattgaattgtacagtttcatagcatgatcgatttgtccagacgcagcatg |
38729732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University