View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19367_low_6 (Length: 274)

Name: NF19367_low_6
Description: NF19367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19367_low_6
NF19367_low_6
[»] chr6 (1 HSPs)
chr6 (150-250)||(24414221-24414321)
[»] chr4 (1 HSPs)
chr4 (115-153)||(48011384-48011422)
[»] chr5 (1 HSPs)
chr5 (40-81)||(30397397-30397438)


Alignment Details
Target: chr6 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 150 - 250
Target Start/End: Complemental strand, 24414321 - 24414221
Alignment:
150 attattagttgatttgagataaatcagtcccgtcttttatcctattgtgaaggagcgtatttcttaaatcctattgaagttattggtgaataggcaagaa 249  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||    
24414321 attattagttgatttgagataaatcagtcccgtcttttatcctattgtgaaggaacatatttcttaaatcctattgaagttattggtgaataggcaagaa 24414222  T
250 c 250  Q
    |    
24414221 c 24414221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 153
Target Start/End: Original strand, 48011384 - 48011422
Alignment:
115 atgaggcagagaatatgacatgggaatcaaagtacatta 153  Q
    ||||||||||| || ||||||||||||||||||||||||    
48011384 atgaggcagagcatgtgacatgggaatcaaagtacatta 48011422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 40 - 81
Target Start/End: Complemental strand, 30397438 - 30397397
Alignment:
40 tggtatttcttaggaatgttttctagacgaacctatattgca 81  Q
    |||||||||||| || |||||||||||| |||||||||||||    
30397438 tggtatttcttaagactgttttctagactaacctatattgca 30397397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University