View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19367_low_6 (Length: 274)
Name: NF19367_low_6
Description: NF19367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19367_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 150 - 250
Target Start/End: Complemental strand, 24414321 - 24414221
Alignment:
| Q |
150 |
attattagttgatttgagataaatcagtcccgtcttttatcctattgtgaaggagcgtatttcttaaatcctattgaagttattggtgaataggcaagaa |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24414321 |
attattagttgatttgagataaatcagtcccgtcttttatcctattgtgaaggaacatatttcttaaatcctattgaagttattggtgaataggcaagaa |
24414222 |
T |
 |
| Q |
250 |
c |
250 |
Q |
| |
|
| |
|
|
| T |
24414221 |
c |
24414221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 153
Target Start/End: Original strand, 48011384 - 48011422
Alignment:
| Q |
115 |
atgaggcagagaatatgacatgggaatcaaagtacatta |
153 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
48011384 |
atgaggcagagcatgtgacatgggaatcaaagtacatta |
48011422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 40 - 81
Target Start/End: Complemental strand, 30397438 - 30397397
Alignment:
| Q |
40 |
tggtatttcttaggaatgttttctagacgaacctatattgca |
81 |
Q |
| |
|
|||||||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
30397438 |
tggtatttcttaagactgttttctagactaacctatattgca |
30397397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University