View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19368_high_32 (Length: 360)
Name: NF19368_high_32
Description: NF19368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19368_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 137 - 341
Target Start/End: Complemental strand, 32958984 - 32958780
Alignment:
| Q |
137 |
gtgtagtttctatctttgacccattgaaatgtgttgttgtctagtggactagacgcataacaagccaagtaagaaaccaagagagtgttgctttgatcat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958984 |
gtgtagtttctatctttgacccattgaaatgtgttgttgtctagtggactagacgcataacaagccaagtaagaaaccaagagagtgttgctttgatcat |
32958885 |
T |
 |
| Q |
237 |
tgcagggtatacctttatctctttagctttttcttcttaatattgtgatccaaatttcaggattcatcttgtttgttatacggctaatactgttgccctc |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958884 |
tgcagggtatacctttatctctttagctttttcttcttaatattgtgatccaaatttcaggattcatcttgtttgttatacggctaatactgttgccctc |
32958785 |
T |
 |
| Q |
337 |
gtcat |
341 |
Q |
| |
|
||||| |
|
|
| T |
32958784 |
gtcat |
32958780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 13 - 72
Target Start/End: Complemental strand, 32959126 - 32959067
Alignment:
| Q |
13 |
aatattccataggagagattgtttgtacttagctatcatgaacgtagggtcccataaccc |
72 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
32959126 |
aatattccataggagagattgtttggacttagctatcatgaatgtagggtcccataaccc |
32959067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University