View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19368_high_34 (Length: 354)
Name: NF19368_high_34
Description: NF19368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19368_high_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 102 - 340
Target Start/End: Complemental strand, 4264242 - 4264004
Alignment:
| Q |
102 |
gtgtacacttttgcatgcacaaatgaatgaattcataaaccatttctgggttttgcagattttccttcatggaagaagcttccacagtctactcttccat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4264242 |
gtgtacacttttgcatgcacaaatgaatgaattcataagccatttctgggttttgcagattttcctttatggaagaagcttccacagtctactcttccat |
4264143 |
T |
 |
| Q |
202 |
tagtagctgatttcattataaaaaatggggttatatacacaagtgacgagtctctcccatttgcaaactccatggcagttgctaatggaagggttattcg |
301 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4264142 |
tagtatctgatttcattataaaaaatggggttatatacacaagtgatgagtctctcccatttgcaaactccatggcagttgctaatggaagggttattcg |
4264043 |
T |
 |
| Q |
302 |
tattggaaacttctcttttgtccaggttcatttcatttc |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4264042 |
tattggaaacttctcttttgtccaggttcatttcatttc |
4264004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 25 - 77
Target Start/End: Complemental strand, 4264327 - 4264275
Alignment:
| Q |
25 |
tctacttctagccatactcattgcttctctccatcttctccaccccacatgta |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4264327 |
tctacttctagccatactcattgcttctctccatcttctccaccccacatgta |
4264275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University