View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19368_high_40 (Length: 334)
Name: NF19368_high_40
Description: NF19368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19368_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 45342941 - 45343138
Alignment:
| Q |
1 |
tttccctaccacccacctttgctatacgtatgcattgtcagaatatctgaattgccttatgctttgtggttttcagactataagattgaaaatgaaggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
45342941 |
tttccctaccacccacctttgctatacgtatgcattgtcagaatatctgaattgccttatgctttgtgtttttcagactataaaattgaaaatgaaggag |
45343040 |
T |
 |
| Q |
101 |
gtgtttgttttagtcttttagatttgtggggttggattggatttaaccatggttagttagaggaaccgcacgtggggagttttaagttttaactgtggcc |
200 |
Q |
| |
|
| ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45343041 |
ggttttgttttagtcttttagatttgggggg-----ttggatttaaccatggttagttagaggaaccgcacgtggggagttttaagttttaactgtggcc |
45343135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 253 - 327
Target Start/End: Original strand, 45343171 - 45343245
Alignment:
| Q |
253 |
tagtatcattcacattctctttggttaatgatgagctaccaaagcaaatgcgccttttttgtttcttcatctctc |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45343171 |
tagtatcattcacattctctttggttaatgatgagctaccaaagcaaatgcgccttttttgtttcttcatctctc |
45343245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University