View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19368_high_42 (Length: 329)
Name: NF19368_high_42
Description: NF19368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19368_high_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 75; Significance: 2e-34; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 81 - 203
Target Start/End: Complemental strand, 29167846 - 29167725
Alignment:
| Q |
81 |
ttttcatattgattttgtcttgcgtttcattcatgaaatgcttgcatataaagcatctcaatataaccggaacaagcgtattcagcatttgcctgataac |
180 |
Q |
| |
|
|||||||||| ||| | |||||| |||||||||| || |||||||||||| |||||||||||||||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
29167846 |
ttttcatattcattct-tcttgcttttcattcattaagtgcttgcatatatagcatctcaatataaccggaaccagggtattcaacatttgcctgataac |
29167748 |
T |
 |
| Q |
181 |
aatgctaaatgaattgtaaaaca |
203 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
29167747 |
aatgctaaaggaattgtaaaaca |
29167725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 37 - 189
Target Start/End: Complemental strand, 29169803 - 29169661
Alignment:
| Q |
37 |
tgcaaaggaaagaaatagtaacatgctaagggaaccctaagcccttttcatattgattttgtcttgcgtttcattcatgaaatgcttgcatataaagcat |
136 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| ||||||| ||||||||||||||||||||||| |||||||||| || ||||||| |||| || || |
|
|
| T |
29169803 |
tgcaaaggaaagaaatagtaacttggtaagggaaaactaagcc-ttttcatattgattttgtcttgcttttcattcatcaagtgcttgcgtatatagtat |
29169705 |
T |
 |
| Q |
137 |
ctcaatataaccggaacaagcgtattcagcatttgcctgataacaatgctaaa |
189 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29169704 |
ctcaatat---------aagcgtattcagcatttgcctgataacaatgctaaa |
29169661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 236 - 308
Target Start/End: Complemental strand, 29166007 - 29165934
Alignment:
| Q |
236 |
attaccctgtataccatatt-acatgatactgtacaaccatagctaccataattacattatttttaacaagctc |
308 |
Q |
| |
|
|||||||| ||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29166007 |
attaccctatatactatatttacatgatgctgtacaaccatagctaccataattacattatttttaacaagctc |
29165934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University