View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19368_high_63 (Length: 238)
Name: NF19368_high_63
Description: NF19368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19368_high_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 160
Target Start/End: Original strand, 47906883 - 47907025
Alignment:
| Q |
18 |
cttattcacttgcattaaatataatagggatgtatgatgttaatcttgttagagtggtgaaatcggtgaatggatttagggaagaatgggagaaaatggg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47906883 |
cttattcacttgcattaaatataatagggatatatgatgttaatcttgttagagtggtgaaatcggtgaatggatttagggaagaatgggagaaaatgag |
47906982 |
T |
 |
| Q |
118 |
ggatattgatgtgatgaagaaatataggatggtttgtgatctc |
160 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47906983 |
ggatattgatgtgatgaagaaatatatgatggtttgtgatctc |
47907025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University