View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19368_high_63 (Length: 238)

Name: NF19368_high_63
Description: NF19368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19368_high_63
NF19368_high_63
[»] chr1 (1 HSPs)
chr1 (18-160)||(47906883-47907025)


Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 160
Target Start/End: Original strand, 47906883 - 47907025
Alignment:
18 cttattcacttgcattaaatataatagggatgtatgatgttaatcttgttagagtggtgaaatcggtgaatggatttagggaagaatgggagaaaatggg 117  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
47906883 cttattcacttgcattaaatataatagggatatatgatgttaatcttgttagagtggtgaaatcggtgaatggatttagggaagaatgggagaaaatgag 47906982  T
118 ggatattgatgtgatgaagaaatataggatggtttgtgatctc 160  Q
    |||||||||||||||||||||||||| ||||||||||||||||    
47906983 ggatattgatgtgatgaagaaatatatgatggtttgtgatctc 47907025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University