View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19368_high_67 (Length: 225)
Name: NF19368_high_67
Description: NF19368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19368_high_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 18947448 - 18947665
Alignment:
| Q |
1 |
tcttcctccattgccgaccctttacgtcaatcatcatcttcttcctccattgttctgtttctctttgttctatttttctcattatcactgcttatgtctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18947448 |
tcttcctccattgccgaccctttacgtcaatcatcatcttcttcctccattgttctgtttctctttgttctatttttctcattatcactgcttatgtctc |
18947547 |
T |
|
| Q |
101 |
taactcttctttttgatgggtcataaaaattaagtatgattccaagtctggaatcaacaacacaaccaccgtcttaaactctctattctcttcaagccac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18947548 |
taactcttctttttgatgggtcataaaaattaagtatgattccaagtctggaatcaacaacacaaccaccgtcttaaactctctattctcttcaagccac |
18947647 |
T |
|
| Q |
201 |
cgtcaccaatttcatctc |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
18947648 |
cgtcaccaatttcatctc |
18947665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 51 - 167
Target Start/End: Original strand, 6204782 - 6204902
Alignment:
| Q |
51 |
tgttctgtttctctttgttctatttttctcattatca----ctgcttatgtctctaactcttctttttgatgggtcataaaaattaagtatgattccaag |
146 |
Q |
| |
|
|||| ||||||||||||||| |||| ||| ||||||| |||| |||||||| |||||||||||||||| |||| ||| |||||||||||||||| |
|
|
| T |
6204782 |
tgttatgtttctctttgttccatttctctaattatcaatcactgccgatgtctctttctcttctttttgatggatcatccaaaataagtatgattccaag |
6204881 |
T |
|
| Q |
147 |
tctggaatcaacaacacaacc |
167 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
6204882 |
tctggaatcaacagcacaacc |
6204902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University