View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19368_low_20 (Length: 440)
Name: NF19368_low_20
Description: NF19368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19368_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 19 - 270
Target Start/End: Original strand, 45342544 - 45342796
Alignment:
| Q |
19 |
gatttctctatgcagttctattattgaaatgaagggaacaagaaagagaaaataggagcggcgaataggtaaaaagaagaagttgaaggaacaaaaatgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342544 |
gatttctctatgcagttctattattgaaatgaagggaacaagaaagagaaaataggagcggcgaataggtaaaaagaagaagttgaaggaacaaaaatgg |
45342643 |
T |
|
| Q |
119 |
cagagaatgtgac--aaaaaactggaacgtgaaataaagttgaaaatgcattaatgaggtaaacaatggcatggtatactatttggttgttgtttttccg |
216 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342644 |
cagagaatgtgacaaaaaaaactggaacgtgaaataaagttgaaaatgcattaatgaggt-aacaatggcatggtatactatttggttgttgtttttccg |
45342742 |
T |
|
| Q |
217 |
tttatatcccagacaatggtcacaccagacaatacacagagcttgtaaattacc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342743 |
tttatatcccagacaatggtcacaccagacaatacacagagcttgtaaattacc |
45342796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 45342920 - 45342964
Alignment:
| Q |
384 |
accctgagacgacgcttctgatttccctaccacccacctttgcta |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342920 |
accctgagacgacgcttctgatttccctaccacccacctttgcta |
45342964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University