View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19368_low_31 (Length: 365)
Name: NF19368_low_31
Description: NF19368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19368_low_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 348
Target Start/End: Original strand, 50605029 - 50605391
Alignment:
| Q |
1 |
gacagttggaaatatttattattcatttactcctctttcaaatgtggcagttgagaaatattgaaatttgaaatcaacctttcatccttcactatataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50605029 |
gacagttggaaatatttattattcatttactcctctttcaaatgtggcagttgagaaatattgaaatttgaaatcaacctttcatccttcactatataat |
50605128 |
T |
|
| Q |
101 |
ataacctcactactccttccttcaatactacacattcattaagttcgctaacaatgagagttttttctaatggcgttgtggttgctttcatcctgtgcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50605129 |
ataacctcactactccttccttcaatactacacattcattaagttcactaacaatgagagttttttctaatggcgttgtggttgctttcatcctgtgcaa |
50605228 |
T |
|
| Q |
201 |
tattctacttgtcactggcttgtttgaagtggcggatggtagacaagttaaggatgataagcatttg---------------attcatccaccacatttg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50605229 |
tattctacttgtcactggcttgtttgaagtggcggatggtagacaagttaaggatgataagcatttgattcatccaccattcattcatccaccacatttg |
50605328 |
T |
|
| Q |
286 |
ttaggtcacggattcaaacatggaaggtttggtggtggtggcattggtgctggtggaggttta |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50605329 |
ttaggtcacggattcaaacatggaaggtttggtggtggtggcattggtgctggtggaggttta |
50605391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University