View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19368_low_47 (Length: 312)
Name: NF19368_low_47
Description: NF19368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19368_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 106 - 297
Target Start/End: Complemental strand, 45303746 - 45303555
Alignment:
| Q |
106 |
ttaaccaagaatttacgagttaaatagttttacacaacggcaaaaccagtttatatgagtgaaaattattgaaactaaaatcaaattatttacaacccgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45303746 |
ttaaccaagaatttacgagttaaatagttttacacaacggcaaaaccagtttatatgagtgaaaattattgaaactaaaatcaaattatttacaacccgg |
45303647 |
T |
 |
| Q |
206 |
tttatatgaaatttatgatatacaattttgcctccatgaagtaaagtttctagatccgttcctagacacaactacatattttgtaactattt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45303646 |
tttatatgaaatttatgatatacaattttgcctccatgaaataaagtttctagatccgttcctagacacaactacatattttgtaactattt |
45303555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University