View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19368_low_57 (Length: 253)
Name: NF19368_low_57
Description: NF19368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19368_low_57 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 17 - 103
Target Start/End: Original strand, 43804033 - 43804119
Alignment:
| Q |
17 |
cagagacagaaatatcaaatttgtaatagtagatcatgatgtctccaagaagaaaattatgtttgtttgattgtggtcttgattatt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43804033 |
cagagacagaaatatcaaatttgtaatagtagatcatgatgtctccaagaagaaaattatgtttgtttgattgtggtcttgattatt |
43804119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 170 - 234
Target Start/End: Original strand, 43804189 - 43804253
Alignment:
| Q |
170 |
ccatttagtaatattaatttgagaacagataaactgctagagtgaagagtgatgggggaagacac |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43804189 |
ccatttagtaatattaatttgagaacagataaactgctagagtgaagagtgatgggggaagacac |
43804253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University