View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19368_low_60 (Length: 248)
Name: NF19368_low_60
Description: NF19368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19368_low_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 22777077 - 22777268
Alignment:
| Q |
1 |
gttttggatatatttccagtactaatcatctcaagcttttcatctgcggctgcatctaaacgaacgttcgtggaacagccttgcttttcagtggttaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| || | |||||||||||||||| |
|
|
| T |
22777077 |
gttttggatatatttccagtactaatcatctcaagtttttcatctgcggctgcatctaaacgaacgttggtggaacaatctcgtttttcagtggttaata |
22777176 |
T |
|
| Q |
101 |
aaagaagattggaagagtaaaggatgtataatattatcatgattaggatcaaccaagtgatgatacgttgcctgaatgagtacatttggttt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22777177 |
aaagaagattggaagagtaaaggatgtataatattatcatgattaggatcagccaagtgatgatacgttgcctgaatgagtacatttggttt |
22777268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University