View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19368_low_65 (Length: 233)
Name: NF19368_low_65
Description: NF19368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19368_low_65 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 47254293 - 47254474
Alignment:
| Q |
18 |
acatcaagaataagtgaata--actaatcagcaccatctttcaattcgtaaacattcgagtaggtagaaacatcaatctgaatttcaattatactcttaa |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
47254293 |
acatcaagaataagtgaatataactaatcagcaccatctttcaattcgtaaacattcaagtaggtagaaacatcaatctcaatttcaattttactcttaa |
47254392 |
T |
|
| Q |
116 |
agtcttaaacacccccttaacataaaccaagacaatgataacgtcttaacattttgccacaacttcattgcaatcagccctag |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47254393 |
agtcttaaacacccccttaacataaaccaagacaatgataacgtcttaaca-tttgccacaacttcattgcaatcagccctag |
47254474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University